Mice were housed in controlled conditions in accordance with guidelines from the UK Medical Research Council in Responsibility in Use of Animals for Medical Research (1993). Two female J20 positive animals were killed at 6 months of age to provide splenic material for the TLA study. Furthermore, 3 month hippocampal tissue was collected from J20 animals: N=5, 3 male, 2 female. C57BL/6J controls: N=5, 3 male, 2 female. All used for qRT-PCR and western blotting. All experiments were conducted under license from the UK Home Office and with Local Ethical Review approval. Tg(PDGFB-APPSwInd)20Lms/2Mmjax animals (J20) were obtained from The Jackson laboratory (stock no. 034836) and maintained on a C57BL/6J background in our animal facility. Chmp2b knockout animals were already available in our animal facility ( Ghazi-Noori et al., 2012). Mice had access to a mouse house with bedding material and wood chips. All animals had continual access to water and RM1 (Special Diet Services) (stock animals) or RM3 (Special Diet Services) (breeding animals) chow ad libitum. Mice were housed in individually ventilated cages in a specific pathogen free facility with a 12 hour light/dark cycle.

DNA was extracted from tail tip or ear biopsy by the HOTSHOT method ( Truett et al., 2000).

The presence of the J20 human APP transgene was tested by PCR using primers (Eurofins) APP-F: 5’-GTGAGTTTGTAAGTGATGCC-3’ APP-R: 5’-TCTTCTTCTTCCACCTCAGC-3’, control primers ContF: 5’-CAAATGTTGCTTGTCTGGTG-3’ ContR: 5’-GTCAGTCGAGTGCACAGTTT-3). Copy number of the human APP transgene was validated by quantitative PCR using a Taqman Fast machine (Applied Biosystems) with the following primers and probes: h APPF: 5’-TGGGTTCAAACAAAGGTGCAA-3’ h APPR: 5’-GATGAAGATCACTGTCGCTATGAC-3’ hAPPprobe: FAM-CATTGGACTCATGGTGGGCGGTG-3’ qContF: 5’-CACGTGGGCTCCAGCATT-3’ qContR: 5’-TCACCAGTCATTTCTGCCTTTG-3’ qContProbe: VIC-CCAATGGTCGGGCACTGCTCAA-3’.

The Chmp2b knockout locus was detected by PCR with the following primers: Int2_F: 5’-CCATTGCCACTTGGATGTAA-3’ Int2_R: 5’-GACGCACTTTAAGGTCACAGC-3’ KO_R: 5’- TCTCTGTGCAAGAAGCATGAA-3’. PCR products were separated by agarose gel electrophoresis and visualised using a BioRad Gel Doc XR UV transilluminator.

Mice were sacrificed by rising concentration of CO ₂ and confirmed by dislocation of the neck and the spleen dissected and kept on ice. Splenocytes were then dissociated through a 40µm mesh filter and the cells collected by centrifugation at 4°C at 500 × g for 5 minutes. The supernatant was discarded and the pellet re-suspended in 1 ml red blood cell lysis buffer (4.13g NH ₄Cl, 0.5g KHCO ₃, 193.5µl 0.5M EDTA dissolved in 500ml H ₂O) for three minutes at room temperature to lyse splenic erythrocytes. To terminate the lysis reaction, 0.5ml phosphate buffered saline (PBS) was added and the splenocytes were collected again by centrifugation at 500 × g for 5 minutes. The supernatant was discarded and the pellet re-suspended in 0.5ml PBS before a final centrifugation step for 2 minutes. The supernatant was discarded and the pellet was re-suspended in 1ml freezing buffer (PBS with 10% fetal calf serum and 10% dimethyl sulphoxide). Samples were stored at -80°C before preparation for TLA processing.

Processing of samples for TLA was performed by Cergentis B.V. (Utrecht, The Netherlands), as previously described ( de Vree et al., 2014). A primer pair targeted to the APP transgene sequence was used to perform the TLA. Sequences of the PCR primers are (5’ to 3’): 1917_APP_F GAAACTCATCTTCACTGGCA; 1698_APP_R GGGTAGACTTCTTGGCAATA. PCR products were purified and library prepped using the Illumina NexteraXT protocol and sequenced on an Illumina Miniseq sequencer.

TLA reads were mapped using BWA-SW, which is a Smith-Waterman alignment tool. This allows for partial mapping, which is optimally suited for identifying break-spanning reads. The mouse Mm10 genome assembly version was used for mapping. Visualisation and interpretation of the data were performed using the Integrative Genomics Viewer (IGV) from the Broad Institute ( Robinson et al., 2011).

RNA was extracted from whole hippocampus from J20 animals and age and litter matched controls. Total RNA was extracted using the Qiagen miRNeasy kit and reverse transcribed using the Applied Biosystems High-Capacity RNA-to-cDNA™ Kit.

Quantitative RT-PCR was carried out on the Zbtb20 gene transcript using a predesigned PrimeTime ^® probe-based qPCR assay (assay ID: Mm.PT.58.41805451, Integrated DNA Technologies [IDT]) targeted to exons 8–9 (RefSeq transcript NM_181058) with a FAM probe. TaqMan reactions were run with Taqman Universal Master Mix 2 on a 7500 Fast machine (Applied Biosystems) using standard cycling conditions. Transcript levels were normalised against Applied Biosystems mouse Actb (Assay ID: 4352933E) and Integrated DNA Technologies B2m (assay ID: Mm.PT.39a.22214835) endogenous controls in independent experiments and the results averaged geometrically. Both controls contained VIC probes.

For analysis of ZBTB20 in hippocampus, J20 and age/sex-matched wildtype littermate controls were dissected under ice-cold PBS before homogenisation in radioimmunoprecipitation buffer (150mM sodium chloride, 50mM Tris, 1% NP-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulphate) with Protease Inhibitor Cocktail Set 1 (Merck). Total protein concentration was determined using Bradford assay (Bio-Rad). Samples from individual animals were run separately and not pooled.

Equal amounts of hippocampal brain proteins were denatured in LDS sample buffer (ThermoFisher) and β-Mercaptoethanol for 10 minutes at 100°C, prior to separation by SDS polyacrylamide gel electrophoresis in 4–12% pre-cast gels (ThermoFisher). Separated proteins were transferred to 0.2µm nitrocellulose membrane and blocked in 5% milk/phosphate buffered saline (with 0.05% Tween 20, PBST) for one hour at room temperature. The membrane was then cut horizontally at the 49KDa band (SeeBlue Plus II protein ladder, Invitrogen) and the lower half was incubated in mouse monoclonal antibody to β-Actin (A5441, Sigma-Aldrich) diluted 1:200,000 in 1% bovine serum albumin (BSA)/PBST overnight at 4°C. The upper half was incubated overnight with rabbit polyclonal primary antibody against ZBTB20 (23987-1-AP, ProteinTech) diluted 1:1000 in 1% BSA/PBST. After washing with PBST the upper and lower membranes were incubated with HRP-conjugated secondary rabbit and mouse antibodies, respectively, diluted in 1% BSA/PBST for 1 hour at room temperature. SuperSignal™ West Pico Chemiluminescent Substrate and X-ray film was used to visualise bands, Image J 1.49c software (NIH) was used to analyse band intensity. Graphpad prism 5 (Graphpad Software, Inc.) was used to plot graphs and SPSS 25 (IBMCorp) was used to perform statistical analyses.

To investigate the role of Chmp2b in the pathogenesis of AD, we attempted to generate a homozygous knockout of Chmp2b in the Tg(PDGFB-APPSwInd)20Lms (J20) APP transgenic mouse strain. To accomplish this we set up matings over two generations ( Figure 1a), firstly between Chmp2b ^-/- and hemizygous J20 mice (referred for simplicity as TgAPP ^J20/-, where ‘J20’ denotes the presence of the transgene). This cross produced Chmp2b ^+/-;Tg APP ^J20/- and Chmp2b ^+/-;Tg APP ^-/- progeny. In the second stage, the Chmp2b ^+/-;Tg APP ^J20/- offspring were crossed to Chmp2b ^-/- null animals. This cross was predicted to produce four progeny genotypes at equal Mendelian ratios (0.25): (i)

homozygous for Chmp2b knockout, without the APP transgene ( Chmp2b ^-/-;Tg APP ^-/-),

The second stage cross resulted in 76 progeny, but the observed ratio of genotypes significantly differed from the expected ratio ( Figure 1b). Strikingly no Chmp2b ^-/-;Tg APP ^J20/- progeny were produced. This suggests that either Chmp2b ^-/-;Tg APP ^J20 may not be viable or the Tg APP allele might be on the same chromosome as Chmp2b - mouse chromosome 16 (Mmu16), preventing typical Mendelian segregation.

To determine the cause of the absence of Chmp2b ^-/-;Tg APP ^J20 offspring, we mapped the site of the J20 Tg APP transgene insertion, and so sequenced flanking regions around the insertion site by TLA. Sequence analysis ( Figure 2a) showed that the Tg APP insertion site lies on Mmu16. Targeted reads mapped the integration breakpoints to genomic co-ordinates Mmu16: 43,127,050 (3’ end of the transgene array) and Mmu16: 43,127,512 (5’ end of the transgene array). In addition, sequencing around the insertion site revealed a 41.17kb deletion in the mouse genome between chr16:43,085,979 and chr16:43,127,149 ( Figure 2b). Thus the lack of Chmp2b ^-/-;Tg APP ^J20 offspring is the result of the insertion of TgAPP ^J20 on Mmu16, explaining the absence of Chmp2b ^-/-;Tg APP ^J20 progeny from the stage 2 cross.

TLA also allowed us to assess transgene sequence integrity. We found three SNPs (hAPP transgene sequence: 624 G > A, 979 G > A, 10649 G > A) and four indels (TG: 185 G > +1T, TG: 1168 G > +8GGCGGGAC, TG: 1423 C > +1G, TG: 5932 C > -1T) within the integrated transgene construct; however, all were silent mutations or found within intronic sequence. Furthermore, TLA analysis showed at least one transgene copy is truncated at the 3’ end (TG: 12088), ablating the ampicillin cassette, and is fused to the 5’ of another transgene copy to form a concatemer (TG:12088 fused to TG:3).

The integration site co-ordinates localize the J20 transgene insertion and deletion entirely within intron 1 of the gene Zinc-finger and BTB domain containing 20 (Zbtb20, transcript NM_001285805.1) on Mmu16. Zbtb20 is a member of the BTB/POZ family of transcriptional repressors and functions primarily as a transcriptional repressor ( Xie et al., 2008); it is important for hippocampal development and function, the site of greatest Aβ deposition in aging J20 animals ( Mucke et al., 2000). Moreover, missense mutations in this gene are associated with Primrose syndrome, a cause of intellectual disability with autism ( Cordeddu et al., 2014; Mattioli et al., 2016). Additionally, haploinsufficiency of the gene has been suggested as an important factor in del3q13.31 syndrome, a cause of developmental delay and intellectual disability ( Rasmussen et al., 2014). To determine whether transgene insertion has affected Zbtb20 transcription in J20 animals in hippocampal tissue, we investigated mRNA and protein levels of ZBTB20 in wildtype and J20 animals.

Firstly, a predesigned RT-qPCR assay was chosen from IDT to overlap the exon 8–9 boundary within the protein coding region of the Zbtb20 transcript, downstream of the transgene insertion site. Importantly this junction is present in all predicted RefSeq protein coding transcript isoforms. We detected significantly less transcript in J20 animals compared to wildtype using this assay ( Figure 3a). To determine whether reduction in Zbtb20 transcript results in a reduction of ZBTB20 protein in J20 animals, we assayed total hippocampal protein by western blot for ZBTB20 with an affinity purified polyclonal antibody, and observed that no change in ZBTB20 protein level in adult J20 hippocampal tissue could be determined by this method. We aimed to validate this result with another antibody (ab48889, Abcam) however, we were unable to determine a specific band at the correct molecular weight (data not shown). Because of the postnatal lethality demonstrated in Zbtb20 ^-/- mice ( Sutherland et al., 2009) and the complexity in producing control adult Zbtb20 ^-/- hippocampal tissue, we were not able to validate this result using an appropriate negative control.