<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">Wellcome Open Res</journal-id>
            <journal-title-group>
                <journal-title>Wellcome Open Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2398-502X</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/wellcomeopenres.12237.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                    <subj-group>
                        <subject>Animal Genetics</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Cognitive Neurology &amp; Dementia</subject>
                    </subj-group>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>The integration site of the 
                    <italic>APP </italic>transgene in the J20 mouse model of Alzheimer&#x2019;s disease</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 1 approved, 2 approved with reservations]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Tosh</surname>
                        <given-names>Justin L.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-1857-995X</uri>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Rickman</surname>
                        <given-names>Matthew</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Rhymes</surname>
                        <given-names>Ellie</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Norona</surname>
                        <given-names>Frances E.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Clayton</surname>
                        <given-names>Emma</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Mucke</surname>
                        <given-names>Lennart</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-6256-9559</uri>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Isaacs</surname>
                        <given-names>Adrian M.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Fisher</surname>
                        <given-names>Elizabeth M.C.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-2850-9936</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Wiseman</surname>
                        <given-names>Frances K.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="corresp" rid="c2">b</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Department of Neurodegenerative Disease, Institute of Neurology, University College London, London, WC1N 3BG, UK</aff>
                <aff id="a2">
                    <label>2</label>Gladstone Institute of Neurological Disease and University of California, San Francisco, CA, 4158, USA</aff>
                <aff id="a3">
                    <label>3</label>UK Dementia Research Institute, University College London, London, WC1E 6BT, UK</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:elizabeth.fisher@ucl.ac.uk">elizabeth.fisher@ucl.ac.uk</email>
                </corresp>
                <corresp id="c2">
                    <label>b</label>
                    <email xlink:href="mailto:f.wiseman@prion.ucl.ac.uk">f.wiseman@prion.ucl.ac.uk</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>The authors declare no competing interests.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>13</day>
                <month>9</month>
                <year>2017</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2017</year>
            </pub-date>
            <volume>2</volume>
            <elocation-id>84</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>16</day>
                    <month>7</month>
                    <year>2026</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2017 Tosh JL et al.</copyright-statement>
                <copyright-year>2017</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://wellcomeopenresearch.org/articles/2-84/pdf"/>
            <abstract>
                <p>
                    <bold>Background:</bold> Transgenic animal models are a widely used and powerful tool to investigate human disease and develop therapeutic interventions. Making a transgenic mouse involves random integration of exogenous DNA into the host genome that can have the effect of disrupting endogenous gene expression. The J20 mouse model of Alzheimer&#x2019;s disease (AD) is a transgenic overexpresser of human APP with familial AD mutations and has been extensively utilised in preclinical studies and our aim was to determine the genomic location of the J20 transgene insertion.</p>
                <p>
                    <bold>Methods:</bold> We used a combination of breeding strategy and Targeted Locus Amplification with deep sequencing to identify the insertion site of the J20 transgene array. To assess RNA and protein expression of 
                    <italic toggle="yes">Zbtb20,</italic> we used qRT-PCR and Western Blotting.</p>
                <p>
                    <bold>Results:</bold> We demonstrate that the J20 transgene construct has inserted within the genetic locus of endogenous mouse gene 
                    <italic toggle="yes">Zbtb20</italic> on chromosome 16 in an array, disrupting expression of mRNA from this gene in adult hippocampal tissue, while expression of 
                    <italic toggle="yes">Zbtb20</italic> protein remains unchanged. We note that the endogenous mouse 
                    <italic toggle="yes">App</italic> gene also lies on chromosome 16, although 42 Mb from the 
                    <italic toggle="yes">Zbtb20</italic> locus.</p>
                <p>
                    <bold>Conclusions:</bold> These data will be useful for future studies utilising this popular model of AD, particularly those investigating gene interactions between the J20 
                    <italic toggle="yes">APP</italic> transgene and other genes present on Mmu16 in the mouse.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Transgenic</kwd>
                <kwd>mouse model</kwd>
                <kwd>Alzheimer&#x2019;s disease</kwd>
                <kwd>APP</kwd>
                <kwd>Zbtb20</kwd>
                <kwd>J20</kwd>
                <kwd>Amyloid Precursor Protein</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1" xlink:href="http://dx.doi.org/10.13039/501100000320">
                    <funding-source>Alzheimer's Society</funding-source>
                    <award-id>192(ALZSOC-PhD-2013-001)</award-id>
                </award-group>
                <award-group id="fund-2" xlink:href="http://dx.doi.org/10.13039/501100000265">
                    <funding-source>Medical Research Council</funding-source>
                    <award-id>MR/J004022/1</award-id>
                </award-group>
                <award-group id="fund-3" xlink:href="http://dx.doi.org/10.13039/501100002283">
                    <funding-source>Alzheimer&#x2019;s Research UK</funding-source>
                    <award-id>ARUK-PPG2014B-5</award-id>
                </award-group>
                <award-group id="fund-4" xlink:href="http://dx.doi.org/10.13039/100004440">
                    <funding-source>Wellcome Trust</funding-source>
                    <award-id>098330</award-id>
                </award-group>
                <funding-statement>This work was supported by the Wellcome Trust [098330], Strategic Award to The London Down Syndrome (LonDownS) Consortium; the Alzheimer&#x2019;s Society [192(ALZSOC-PhD-2013-001)], awarded to FKW and EMCF; the Medical Research Council [MR/J004022/1], to AMI; and Alzheimer&#x2019;s Research UK [ARUK-PPG2014B-5] to AMI.</funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec sec-type="intro">
            <title>Introduction</title>
            <p>The Tg(PDGFB-APPSwInd)20Lms (MGI:3057148, here referred to as &#x2018;J20&#x2019;) mouse model is a transgenic animal that overexpresses mutant human APP protein (amyloid precursor protein), and is widely used as a model of amyloid deposition and pathogenesis in the study of Alzheimer&#x2019;s disease (AD). J20 mice recapitulate many AD-like phenotypes, including synaptic loss, amyloid plaque deposition and cognitive impairment (
                <xref ref-type="bibr" rid="ref-9">Hong 
                    <italic toggle="yes">et al.</italic>, 2016</xref>; 
                <xref ref-type="bibr" rid="ref-13">Mucke 
                    <italic toggle="yes">et al.</italic>, 2000</xref>; 
                <xref ref-type="bibr" rid="ref-17">Palop &amp; Mucke, 2016</xref>).</p>
            <p>The model was developed by Mucke and colleagues using the PDGF-APPSw,Ind transgene construct described previously (
                <xref ref-type="bibr" rid="ref-5">Games 
                    <italic toggle="yes">et al.</italic>, 1995</xref>; 
                <xref ref-type="bibr" rid="ref-22">Rockenstein 
                    <italic toggle="yes">et al.</italic>, 1995</xref>), which includes a human 
                <italic toggle="yes">APP</italic> mini-gene, carrying the familial AD-linked 717
                <sub>V-F</sub> (Indiana) mutation (
                <xref ref-type="bibr" rid="ref-15">Murrell 
                    <italic toggle="yes">et al.</italic>, 1991</xref>) and 670/671
                <sub>KM-NL</sub> (Swedish) double mutation (
                <xref ref-type="bibr" rid="ref-14">Mullan 
                    <italic toggle="yes">et al.</italic>, 1992</xref>). The transgene construct was designed so that the 
                <italic toggle="yes">APP</italic> mini-gene included genomic sequence for 
                <italic toggle="yes">APP</italic> introns 6&#x2013;8, allowing expression of hAPP695, hAPP751 and hAPP770 isoforms. The PDGF-APPSw,Ind transgene expression is driven in neurons throughout the brain by the human platelet-derived growth factor &#x03b2; chain (PDGF&#x03b2;) promoter (
                <xref ref-type="bibr" rid="ref-7">Harris 
                    <italic toggle="yes">et al.</italic>, 2010</xref>; 
                <xref ref-type="bibr" rid="ref-24">Sasahara 
                    <italic toggle="yes">et al.</italic>, 1991</xref>). The J20 mouse is an important model: currently, 125 articles have been catalogued in the Mouse Genome Database bibliography (
                <xref ref-type="bibr" rid="ref-2">Blake 
                    <italic toggle="yes">et al.</italic>, 2017</xref>), which report genotypic and/or phenotypic data from this mouse. This strain has been used for several classical genetic studies to determine the interaction of genes of interest with the 
                <italic toggle="yes">APP</italic> transgene including a seminal report of the importance of Tau to A&#x00df;-associated neuronal dysfunction (
                <xref ref-type="bibr" rid="ref-20">Roberson 
                    <italic toggle="yes">et al.</italic>, 2007</xref>). Moreover, this model has been used to elucidate the role of A&#x00df; in synaptic dysfunction (
                <xref ref-type="bibr" rid="ref-17">Palop &amp; Mucke, 2016</xref>; 
                <xref ref-type="bibr" rid="ref-18">Palop 
                    <italic toggle="yes">et al.</italic>, 2007</xref>; 
                <xref ref-type="bibr" rid="ref-23">Sanchez 
                    <italic toggle="yes">et al.</italic>, 2012</xref>).</p>
            <p>Transgenic mice are conventionally generated by direct injection of linear foreign DNA into the pronucleus of fertilised zygotes. Once inside the cell, these linear fragments undergo circularisation and concatemer formation before integrating into the host genome as a tandem array (
                <xref ref-type="bibr" rid="ref-1">Bishop &amp; Smith, 1989</xref>). In principle, transgenes insert randomly into the host genome; however, &#x223c;45% of integration sites lie within host gene regions (&#x223c;13.2 exonic, 31.6% intronic), potentially as a result of increased accessibility of transcriptionally active DNA (
                <xref ref-type="bibr" rid="ref-32">Yan 
                    <italic toggle="yes">et al.</italic>, 2013</xref>). Integration of a transgene array into coding sequences can induce new mutations (for example, haploinsufficiency) (
                <xref ref-type="bibr" rid="ref-8">Haruyama 
                    <italic toggle="yes">et al.</italic>, 2009</xref>), and so it is important to know the site of integration for a transgene array in a mouse model.</p>
            <p>A recent study suggested an association of a heterozygous deletion of the 
                <italic toggle="yes">CHMP2B</italic> gene (charged multivesicular body protein 2B) with early-onset Alzheimer&#x2019;s disease (
                <xref ref-type="bibr" rid="ref-10">Hooli 
                    <italic toggle="yes">et al.</italic>, 2014</xref>). Interestingly, mutations in 
                <italic toggle="yes">CHMP2B</italic> are a rare genetic cause of Frontotemporal dementia (
                <xref ref-type="bibr" rid="ref-27">Skibinski 
                    <italic toggle="yes">et al.</italic>, 2005</xref>). We have previously reported generation of a 
                <italic toggle="yes">Chmp2b</italic> knockout mouse (
                <xref ref-type="bibr" rid="ref-6">Ghazi-Noori 
                    <italic toggle="yes">et al.</italic>, 2012</xref>). To determine if 
                <italic toggle="yes">Chmp2b</italic> deletion modulates APP/A&#x00df; biology 
                <italic toggle="yes">in vivo</italic>, we attempted to cross our 
                <italic toggle="yes">Chmp2b</italic> knockout with the J20 mouse, to study potential double mutant progeny. The 
                <italic toggle="yes">Chmp2b</italic> locus lies on mouse chromosome 16.</p>
            <p>Here, we present the outcome of these genetic cross experiments and the resulting mapping of the J20 transgene array integration site by Targeted Locus Amplification (TLA) with deep sequencing. We discuss how integration of the transgene affects expression of the flanking loci.</p>
        </sec>
        <sec sec-type="methods">
            <title>Methods</title>
            <sec>
                <title>Animal welfare</title>
                <p>Mice were housed in controlled conditions in accordance with guidelines from the UK Medical Research Council in Responsibility in Use of Animals for Medical Research (1993). Two female J20 positive animals were killed at 6 months of age to provide splenic material for the TLA study. Furthermore, 3 month hippocampal tissue was collected from J20 animals: N=5, 3 male, 2 female. C57BL/6J controls: N=5, 3 male, 2 female. All used for qRT-PCR and western blotting. All experiments were conducted under license from the UK Home Office and with Local Ethical Review approval. Tg(PDGFB-APPSwInd)20Lms/2Mmjax animals (J20) were obtained from The Jackson laboratory (stock no. 034836) and maintained on a C57BL/6J background in our animal facility. Chmp2b knockout animals were already available in our animal facility (
                    <xref ref-type="bibr" rid="ref-6">Ghazi-Noori 
                        <italic toggle="yes">et al.</italic>, 2012</xref>). Mice had access to a mouse house with bedding material and wood chips. All animals had continual access to water and RM1 (Special Diet Services) (stock animals) or RM3 (Special Diet Services) (breeding animals) chow 
                    <italic toggle="yes">ad libitum</italic>. Mice were housed in individually ventilated cages in a specific pathogen free facility with a 12 hour light/dark cycle.</p>
            </sec>
            <sec>
                <title>Genotyping of J20 and 
                    <italic toggle="yes">Chmp2b</italic> knockout mice</title>
                <p>DNA was extracted from tail tip or ear biopsy by the HOTSHOT method (
                    <xref ref-type="bibr" rid="ref-29">Truett 
                        <italic toggle="yes">et al.</italic>, 2000</xref>).</p>
                <p>The presence of the J20 human APP transgene was tested by PCR using primers (Eurofins) 
                    <italic toggle="yes">APP</italic>-F: 5&#x2019;-GTGAGTTTGTAAGTGATGCC-3&#x2019; 
                    <italic toggle="yes">APP</italic>-R: 5&#x2019;-TCTTCTTCTTCCACCTCAGC-3&#x2019;, control primers ContF: 5&#x2019;-CAAATGTTGCTTGTCTGGTG-3&#x2019; ContR: 5&#x2019;-GTCAGTCGAGTGCACAGTTT-3). Copy number of the human APP transgene was validated by quantitative PCR using a Taqman Fast machine (Applied Biosystems) with the following primers and probes: h
                    <italic toggle="yes">APP</italic>F: 5&#x2019;-TGGGTTCAAACAAAGGTGCAA-3&#x2019; h
                    <italic toggle="yes">APP</italic>R: 5&#x2019;-GATGAAGATCACTGTCGCTATGAC-3&#x2019; hAPPprobe: FAM-CATTGGACTCATGGTGGGCGGTG-3&#x2019; qContF: 5&#x2019;-CACGTGGGCTCCAGCATT-3&#x2019; qContR: 5&#x2019;-TCACCAGTCATTTCTGCCTTTG-3&#x2019; qContProbe: VIC-CCAATGGTCGGGCACTGCTCAA-3&#x2019;.</p>
                <p>The 
                    <italic toggle="yes">Chmp2b</italic> knockout locus was detected by PCR with the following primers: Int2_F: 5&#x2019;-CCATTGCCACTTGGATGTAA-3&#x2019; Int2_R: 5&#x2019;-GACGCACTTTAAGGTCACAGC-3&#x2019; KO_R: 5&#x2019;- TCTCTGTGCAAGAAGCATGAA-3&#x2019;. PCR products were separated by agarose gel electrophoresis and visualised using a BioRad Gel Doc XR UV transilluminator.</p>
            </sec>
            <sec>
                <title>Extraction of spleen cells from J20 animals</title>
                <p>Mice were sacrificed by rising concentration of CO
                    <sub>2</sub> and confirmed by dislocation of the neck and the spleen dissected and kept on ice. Splenocytes were then dissociated through a 40&#x00b5;m mesh filter and the cells collected by centrifugation at 4&#x00b0;C at 500 x 
                    <italic toggle="yes">g</italic> for 5 minutes. The supernatant was discarded and the pellet re-suspended in 1 ml red blood cell lysis buffer (4.13g NH
                    <sub>4</sub>Cl, 0.5g KHCO
                    <sub>3</sub>, 193.5&#x00b5;l 0.5M EDTA dissolved in 500ml H
                    <sub>2</sub>O) for three minutes at room temperature to lyse splenic erythrocytes. To terminate the lysis reaction, 0.5ml phosphate buffered saline (PBS) was added and the splenocytes were collected again by centrifugation at 500 &#x00d7; g for 5 minutes. The supernatant was discarded and the pellet re-suspended in 0.5ml PBS before a final centrifugation step for 2 minutes. The supernatant was discarded and the pellet was re-suspended in 1ml freezing buffer (PBS with 10% fetal calf serum and 10% dimethyl sulphoxide). Samples were stored at -80&#x00b0;C before preparation for TLA processing.</p>
            </sec>
            <sec>
                <title>Targeted Locus Amplification</title>
                <p>Processing of samples for TLA was performed by Cergentis B.V. (Utrecht, The Netherlands), as previously described (
                    <xref ref-type="bibr" rid="ref-4">de Vree 
                        <italic toggle="yes">et al.</italic>, 2014</xref>). A primer pair targeted to the 
                    <italic toggle="yes">APP</italic> transgene sequence was used to perform the TLA. Sequences of the PCR primers are (5&#x2019; to 3&#x2019;): 1917_APP_F GAAACTCATCTTCACTGGCA; 1698_APP_R GGGTAGACTTCTTGGCAATA. PCR products were purified and library prepped using the Illumina NexteraXT protocol and sequenced on an Illumina Miniseq sequencer.</p>
            </sec>
            <sec>
                <title>Sequence alignment and analysis of TLA</title>
                <p>TLA reads were mapped using 
                    <ext-link ext-link-type="uri" xlink:href="http://bio-bwa.sourceforge.net/">BWA-SW</ext-link>, which is a Smith-Waterman alignment tool. This allows for partial mapping, which is optimally suited for identifying break-spanning reads. The 
                    <ext-link ext-link-type="uri" xlink:href="http://genome-euro.ucsc.edu/cgi-bin/hgGateway?db=mm10&amp;redirect=manual&amp;source=genome.ucsc.edu">mouse Mm10 genome</ext-link> assembly version was used for mapping. Visualisation and interpretation of the data were performed using the Integrative Genomics Viewer (IGV) from the Broad Institute (
                    <xref ref-type="bibr" rid="ref-21">Robinson 
                        <italic toggle="yes">et al.</italic>, 2011</xref>).</p>
            </sec>
            <sec>
                <title>RNA extraction and quantitative reverse transcription PCR</title>
                <p>RNA was extracted from whole hippocampus from J20 animals and age and litter matched controls. Total RNA was extracted using the Qiagen miRNeasy kit and reverse transcribed using the Applied Biosystems High-Capacity RNA-to-cDNA&#x2122; Kit.</p>
                <p>Quantitative RT-PCR was carried out on the 
                    <italic toggle="yes">Zbtb20</italic> gene transcript using a predesigned PrimeTime
                    <sup>&#x00ae;</sup> probe-based qPCR assay (assay ID: Mm.PT.58.41805451, Integrated DNA Technologies [IDT]) targeted to exons 8&#x2013;9 (RefSeq transcript NM_181058) with a FAM probe. TaqMan reactions were run with Taqman Universal Master Mix 2 on a 7500 Fast machine (Applied Biosystems) using standard cycling conditions. Transcript levels were normalised against Applied Biosystems mouse 
                    <italic toggle="yes">Actb</italic> (Assay ID: 4352933E) and Integrated DNA Technologies 
                    <italic toggle="yes">B2m</italic> (assay ID: Mm.PT.39a.22214835) endogenous controls in independent experiments and the results averaged geometrically. Both controls contained VIC probes.</p>
            </sec>
            <sec>
                <title>Tissue preparation and western blotting for ZBTB20</title>
                <p>For analysis of ZBTB20 in hippocampus, J20 and age/sex-matched wildtype littermate controls were dissected under ice-cold PBS before homogenisation in radioimmunoprecipitation buffer (150mM sodium chloride, 50mM Tris, 1% NP-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulphate) with Protease Inhibitor Cocktail Set 1 (Merck). Total protein concentration was determined using Bradford assay (Bio-Rad). Samples from individual animals were run separately and not pooled.</p>
                <p>Equal amounts of hippocampal brain proteins were denatured in LDS sample buffer (ThermoFisher) and &#x03b2;-Mercaptoethanol for 10 minutes at 100&#x00b0;C, prior to separation by SDS polyacrylamide gel electrophoresis in 4&#x2013;12% pre-cast gels (ThermoFisher). Separated proteins were transferred to 0.2&#x00b5;m nitrocellulose membrane and blocked in 5% milk/phosphate buffered saline (with 0.05% Tween 20, PBST) for one hour at room temperature. The membrane was then cut horizontally at the 49KDa band (SeeBlue Plus II protein ladder, Invitrogen) and the lower half was incubated in mouse monoclonal antibody to &#x03b2;-Actin (A5441, Sigma-Aldrich) diluted 1:200,000 in 1% bovine serum albumin (BSA)/PBST overnight at 4&#x00b0;C. The upper half was incubated overnight with rabbit polyclonal primary antibody against ZBTB20 (23987-1-AP, ProteinTech) diluted 1:1000 in 1% BSA/PBST. After washing with PBST the upper and lower membranes were incubated with HRP-conjugated secondary rabbit and mouse antibodies, respectively, diluted in 1% BSA/PBST for 1 hour at room temperature. SuperSignal&#x2122; West Pico Chemiluminescent Substrate and X-ray film was used to visualise bands, Image J 1.49c software (NIH) was used to analyse band intensity. Graphpad prism 5 (Graphpad Software, Inc.) was used to perform statistical analyses and plot graphs.</p>
            </sec>
        </sec>
        <sec sec-type="results">
            <title>Results</title>
            <sec>
                <title>Mouse breeding strategy</title>
                <p>To investigate the role of 
                    <italic toggle="yes">Chmp2b</italic> in the pathogenesis of AD, we attempted to generate a homozygous knockout of 
                    <italic toggle="yes">Chmp2b</italic> in the Tg(PDGFB-APPSwInd)20Lms (J20) 
                    <italic toggle="yes">APP</italic> transgenic mouse strain. To accomplish this we set up matings over two generations (
                    <xref ref-type="fig" rid="f1">Figure 1a</xref>), firstly between 
                    <italic toggle="yes">Chmp2b
                        <sup>-/-</sup>
                    </italic> and hemizygous J20 mice (referred for simplicity as TgAPP
                    <sup>J20/-</sup>, where &#x2018;J20&#x2019; denotes the presence of the transgene). This cross produced 
                    <italic toggle="yes">Chmp2b</italic>
                    <sup>+/-</sup>;Tg
                    <italic toggle="yes">APP</italic>
                    <sup>J20/-</sup> and 
                    <italic toggle="yes">Chmp2b</italic>
                    <sup>+/-</sup>;Tg
                    <italic toggle="yes">APP</italic>
                    <sup>-/-</sup>progeny. In the second stage, the 
                    <italic toggle="yes">Chmp2b</italic>
                    <sup>+/-</sup>;Tg
                    <italic toggle="yes">APP</italic>
                    <sup>J20/-</sup> offspring were crossed to 
                    <italic toggle="yes">Chmp2b</italic>
                    <sup>-/-</sup> null animals. This cross was predicted to produce four progeny genotypes at equal Mendelian ratios (0.25): 
                    <list list-type="bullet">
                        <list-item>
                            <label>(i) </label>
                            <p>homozygous for 
                                <italic toggle="yes">Chmp2b</italic> knockout, without the 
                                <italic toggle="yes">APP</italic> transgene (
                                <italic toggle="yes">Chmp2b</italic>
                                <sup>-/-</sup>;Tg
                                <italic toggle="yes">APP</italic>
                                <sup>-/-</sup>),</p>
                        </list-item>
                        <list-item>
                            <label>(ii) </label>
                            <p>homozygous for 
                                <italic toggle="yes">Chmp2b</italic> knockout, hemizygous for 
                                <italic toggle="yes">APP</italic> transgene (
                                <italic toggle="yes">Chmp2b</italic>
                                <sup>-/-</sup>;Tg
                                <italic toggle="yes">APP</italic>
                                <sup>J20/-</sup>),</p>
                        </list-item>
                        <list-item>
                            <label>(iii) </label>
                            <p>hemizygous for 
                                <italic toggle="yes">Chmp2b</italic> knockout, hemizygous for 
                                <italic toggle="yes">APP</italic> transgene (
                                <italic toggle="yes">Chmp2b</italic>
                                <sup>+/-</sup>;Tg
                                <italic toggle="yes">APP</italic>
                                <sup>J20/-</sup>),</p>
                        </list-item>
                        <list-item>
                            <label>(iv) </label>
                            <p>hemizygous for 
                                <italic toggle="yes">Chmp2b</italic> knockout, without the 
                                <italic toggle="yes">APP</italic> transgene (
                                <italic toggle="yes">Chmp2b</italic>
                                <sup>+/-</sup>;Tg
                                <italic toggle="yes">APP</italic>
                                <sup>-/-</sup>).</p>
                        </list-item>
                    </list>
                </p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>Breeding scheme and observed ratios of offspring in a two-generation cross between 
                            <italic toggle="yes">Chmp2b</italic>
                            <sup>-/-</sup> and J20
                            <sup>+/-</sup> animals.</title>
                        <p>(
                            <bold>A</bold>) Two-generation breeding scheme to generate Chmp2b
                            <sup>-/-</sup>; J20
                            <sup>+/-</sup> animals. (
                            <bold>B</bold>) Observed ratios of offspring genotype differed significantly from the expected ratio &#x03c7;2(3, N = 90.21) = 0.58, p &lt; 0.0001.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://wellcomeopenresearch-files.f1000.com/manuscripts/13248/78601cfe-a059-4db4-8603-7df9a7c7194b_figure1.gif"/>
                </fig>
                <p>The second stage cross resulted in 76 progeny, but the observed ratio of genotypes significantly differed from the expected ratio (
                    <xref ref-type="fig" rid="f1">Figure 1b</xref>). Strikingly no 
                    <italic toggle="yes">Chmp2b</italic>
                    <sup>-/-</sup>;Tg
                    <italic toggle="yes">APP</italic>
                    <sup>J20/-</sup> progeny were produced. This suggests that either 
                    <italic toggle="yes">Chmp2b</italic>
                    <sup>-/-</sup>;Tg
                    <italic toggle="yes">APP</italic>
                    <sup>J20</sup> may not be viable or the Tg
                    <italic toggle="yes">APP</italic> allele might be on the same chromosome as 
                    <italic toggle="yes">Chmp2b -</italic> mouse chromosome 16 (Mmu16), preventing typical Mendelian segregation.</p>
            </sec>
            <sec>
                <title>Targeted locus Amplification analysis of J20 transgene insertion</title>
                <p>To determine the cause of the absence of 
                    <italic toggle="yes">Chmp2b</italic>
                    <sup>-/-</sup>;Tg
                    <italic toggle="yes">APP</italic>
                    <sup>J20</sup> offspring, we mapped the site of the J20 Tg
                    <italic toggle="yes">APP</italic> transgene insertion, and so sequenced flanking regions around the insertion site by TLA. Sequence analysis (
                    <xref ref-type="fig" rid="f2">Figure 2a</xref>) showed that the Tg
                    <italic toggle="yes">APP</italic> insertion site lies on Mmu16. Targeted reads mapped the integration breakpoints to genomic co-ordinates Mmu16: 43,127,050 (3&#x2019; end of the transgene array) and Mmu16: 43,127,512 (5&#x2019; end of the transgene array). In addition, sequencing around the insertion site revealed a 41.17kb deletion in the mouse genome between chr16:43,085,979 and chr16:43,127,149 (
                    <xref ref-type="fig" rid="f2">Figure 2b</xref>). Thus the lack of 
                    <italic toggle="yes">Chmp2b</italic>
                    <sup>-/-</sup>;Tg
                    <italic toggle="yes">APP</italic>
                    <sup>J20</sup> offspring is the result of the insertion of TgAPP
                    <sup>J20</sup> on Mmu16, explaining the absence of 
                    <italic toggle="yes">Chmp2b</italic>
                    <sup>-/-</sup>;Tg
                    <italic toggle="yes">APP</italic>
                    <sup>J20</sup> progeny from the stage 2 cross.</p>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <title>Insertion site of the J20 APP transgene (Tg) on mouse chromosome 16.</title>
                        <p>(
                            <bold>A</bold>) Representation of Mmu16 showing insertion site of the J20 Tg array. Also shown are the positions of endogenous mouse 
                            <italic toggle="yes">App</italic> and 
                            <italic toggle="yes">Chmp2b</italic>. (
                            <bold>B</bold>) TLA applied to the APPSwInd transgene in the J20 mouse. Read mapping to the mouse (mm10) genome assembly shows the exact Tg insertion site (red arrows) with associated genomic deletion (yellow bar). Gene annotation is shown below labelling a small portion of intron 1 of the 
                            <italic toggle="yes">Zbtb20</italic> gene. (
                            <bold>C</bold>) TLA reads mapped to the APP Tg sequence. Complete coverage was achieved, showing that head to tail concatemerization of the Tg has occurred at position 12088 ablating the ampicillin cassette of the plasmid construct. Coloured lines represent SNPs found in the Tg sequence compared to the published sequence. A linearised map of the plasmid construct is shown below.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://wellcomeopenresearch-files.f1000.com/manuscripts/13248/78601cfe-a059-4db4-8603-7df9a7c7194b_figure2.gif"/>
                </fig>
                <p>TLA also allowed us to assess transgene sequence integrity. We found three SNPs (hAPP transgene sequence: 624 G &gt; A, 979 G &gt; A, 10649 G &gt; A) and four indels (TG: 185 G &gt; +1T, TG: 1168 G &gt; +8GGCGGGAC, TG: 1423 C &gt; +1G, TG: 5932 C &gt; -1T) within the integrated transgene construct; however, all were silent mutations or found within intronic sequence. Furthermore, TLA analysis showed at least one transgene copy is truncated at the 3&#x2019; end (TG: 12088), ablating the ampicillin cassette, and is fused to the 5&#x2019; of another transgene copy to form a concatemer (TG:12088 fused to TG:3).</p>
            </sec>
            <sec>
                <title>Assessment of ZBTB20 expression</title>
                <p>The integration site co-ordinates localize the J20 transgene insertion and deletion entirely within intron 1 of the gene Zinc-finger and BTB domain containing 20 
                    <italic toggle="yes">(Zbtb20,</italic> transcript NM_001285805.1) on Mmu16. 
                    <italic toggle="yes">Zbtb20</italic> is a member of the BTB/POZ family of transcriptional repressors and functions primarily as a transcriptional repressor (
                    <xref ref-type="bibr" rid="ref-31">Xie 
                        <italic toggle="yes">et al.</italic>, 2008</xref>); it is important for hippocampal development and function, the site of greatest A&#x03b2; deposition in aging J20 animals (
                    <xref ref-type="bibr" rid="ref-13">Mucke 
                        <italic toggle="yes">et al.</italic>, 2000</xref>). Moreover, missense mutations in this gene are associated with Primrose syndrome, a cause of intellectual disability with autism (
                    <xref ref-type="bibr" rid="ref-3">Cordeddu 
                        <italic toggle="yes">et al.</italic>, 2014</xref>; 
                    <xref ref-type="bibr" rid="ref-12">Mattioli 
                        <italic toggle="yes">et al.</italic>, 2016</xref>). Additionally, haploinsufficiency of the gene has been suggested as an important factor in del3q13.31 syndrome, a cause of developmental delay and intellectual disability (
                    <xref ref-type="bibr" rid="ref-19">Rasmussen 
                        <italic toggle="yes">et al.</italic>, 2014</xref>). To determine whether transgene insertion has affected 
                    <italic toggle="yes">Zbtb20</italic> transcription in J20 animals in hippocampal tissue, we investigated mRNA and protein levels of ZBTB20 in wildtype and J20 animals.</p>
                <p>Firstly, a predesigned RT-qPCR assay was chosen from IDT to overlap the exon 8&#x2013;9 boundary within the protein coding region of the 
                    <italic toggle="yes">Zbtb20</italic> transcript, downstream of the transgene insertion site. Importantly this junction is present in all predicted RefSeq protein coding transcript isoforms. We detected significantly less transcript in J20 animals compared to wildtype using this assay (
                    <xref ref-type="fig" rid="f3">Figure 3a</xref>). To determine whether reduction in 
                    <italic toggle="yes">Zbtb20</italic> transcript results in a reduction of ZBTB20 protein in J20 animals, we assayed total hippocampal protein by western blot for ZBTB20 with an affinity purified polyclonal antibody, and observed that ZBTB20 protein is unaltered in adult J20 hippocampal tissue. We also validated this negative result with an additional antibody to ZBTB20 (data not shown). Thus, any perturbations in transcript abundance of 
                    <italic toggle="yes">Zbtb20</italic> in J20 hippocampus at three months of age do not translate to deficits in ZBTB20 protein.</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3. </label>
                    <caption>
                        <title>Expression of 
                            <italic toggle="yes">Zbtb20</italic> mRNA and protein in 3 month old wildtype and J20
                            <sup>+/-</sup> hippocampus.</title>
                        <p>(
                            <bold>A</bold>) 
                            <italic toggle="yes">Zbtb20</italic> mRNA expression is significantly reduced in J20 hippocampus compared to wildtype (WT), detected by quantitative RT-PCR using primers spanning exons 8&#x2013;9 (unpaired t-test, n = 5 wildtype/6 J20. P = 0.0046). (
                            <bold>B</bold>) ZBTB20 protein levels are unchanged in J20 hippocampus compared to wildtype animals (unpaired t-test, n= 5 wildtype/4 J20 in hippocampus. p = 0.91).</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://wellcomeopenresearch-files.f1000.com/manuscripts/13248/78601cfe-a059-4db4-8603-7df9a7c7194b_figure3.gif"/>
                </fig>
            </sec>
        </sec>
        <sec sec-type="discussion">
            <title>Discussion</title>
            <p>Using TLA we have located the insertion site of the J20 
                <italic toggle="yes">APP</italic> transgene on Mmu16 within intron 1 of the 
                <italic toggle="yes">Zbtb20</italic> gene. We have also found a 41kb deletion of intronic sequence flanking the insertion site. Due to the key role of 
                <italic toggle="yes">Zbtb20</italic> in hippocampal cell differentiation and function, we determined its expression in hippocampal tissue, and found that while 
                <italic toggle="yes">Zbtb20</italic> transcript expression is reduced in J20 hippocampus, protein expression is not. In a similar study investigating the transgene insertion site of the R6/2 Huntingdon&#x2019;s disease model mouse, Jacobsen 
                <italic toggle="yes">et al.</italic> discovered that the 
                <italic toggle="yes">HTT</italic> exon 1 transgene inserted within intron 7 of the 
                <italic toggle="yes">Gm12695</italic> gene, causing an almost 30 fold increase of expression of this gene compared to wildtype in cortical tissue irrespective of CAG-repeat length polymorphisms, showing that the genomic aberration caused by foreign DNA insertion within intronic sequence can alter gene regulation (
                <xref ref-type="bibr" rid="ref-11">Jacobsen 
                    <italic toggle="yes">et al.</italic>, 2017</xref>). Notably, disruption of the expression of nearby genes may also occur in gene-targeted systems. For example, two of the four lines of mice that are null for the Prion protein gene 
                <italic toggle="yes">Prnp</italic>, exhibited late onset ataxia and neurodegeneration -- this was subsequently found to be the result of aberrant upregulation of a gene (
                <italic toggle="yes">Prnd</italic>) downstream of 
                <italic toggle="yes">Prnp</italic>, which occurred as a result of induced exon skipping (
                <xref ref-type="bibr" rid="ref-33">Moore 
                    <italic toggle="yes">et al.</italic>, 1999</xref>). In the J20 model, hippocampal 
                <italic toggle="yes">Zbtb20</italic> transcription is perturbed without concomitant protein reduction. This is perhaps not as surprising as it seems; recent data indicate mRNA levels explain only around 40% of variability in protein levels (
                <xref ref-type="bibr" rid="ref-30">Wilhelm 
                    <italic toggle="yes">et al.</italic>, 2014</xref>), with protein abundance being primarily dependent on translational control (
                <xref ref-type="bibr" rid="ref-25">Schwanh&#x00e4;usser 
                    <italic toggle="yes">et al.</italic>, 2011</xref>, 
                <xref ref-type="bibr" rid="ref-26">Schwanh&#x00e4;usser 
                    <italic toggle="yes">et al.</italic>, 2013</xref>).</p>
            <p>It may be important to assess expression in multiple neuronal cell types throughout development in the J20 model, considering that ectopic expression of 
                <italic toggle="yes">Zbtb20</italic> in the subiculum and post-subiculum results in aberrant CA1 type development in those regions with associated CA1-specific markers (
                <xref ref-type="bibr" rid="ref-16">Nielsen 
                    <italic toggle="yes">et al.</italic>, 2010</xref>). The transgene sequence itself is intact in the J20, excluding several single nucleotide mutations; however, these are either silent or found within the transgene construct&#x2019;s three intronic regions and are unlikely to affect the J20 transgene. TLA analysis and in-house copy number qPCR (data not shown) indicate that this transgene has integrated multiple times in an array on Mmu16. Multiple transgene insertion may be liable to recombination events, causing loss of some copies of the transgene, resulting in delayed onset of phenotype in affected animals. This potential confound can be allayed by undertaking a genomic copy-number qPCR to confirm copy-number consistency between individuals. The Jackson Laboratory have 
                <ext-link ext-link-type="uri" xlink:href="https://www.jax.org/strain/004661">published their assay for general use</ext-link>.</p>
            <p>Genetic engineering can result in unintended disruption of the genome, which can confound interpretation of phenotype if the genomic alterations cause changes in protein expression. Transgenic models have been and continue to be powerful tools for biomedical research, but knowledge of the insertion site and the local effects on gene expression will inform phenotyping studies.</p>
        </sec>
        <sec>
            <title>Data availability</title>
            <p>Aligned BAM files from the TLA, uncropped western blot for 
                <xref ref-type="fig" rid="f3">Figure 3B</xref>, hippocampal qPCR data and western blot data for Zbtb20 are available on OSF 
                <ext-link ext-link-type="uri" xlink:href="http://doi.org/10.17605/OSF.IO/4UGZF">http://doi.org/10.17605/OSF.IO/4UGZF</ext-link> (
                <xref ref-type="bibr" rid="ref-28">Tosh, 2017</xref>).</p>
        </sec>
    </body>
    <back>
        <ack>
            <title>Acknowledgements</title>
            <p>We thank the Medical Research Council Prion Unit Biological Services Facility for animal husbandry and tissue collection services and Dr Rachele Saccon for use of edited mouse diagrams (
                <xref ref-type="fig" rid="f1">Figure 1A</xref>).</p>
        </ack>
        <ref-list>
            <ref id="ref-1">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Bishop</surname>
                            <given-names>JO</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Smith</surname>
                            <given-names>P</given-names>
                        </name>
	</person-group>:
                    <article-title>Mechanism of chromosomal integration of microinjected DNA.</article-title>
                    <source>
		
                        <italic toggle="yes">Mol Biol Med.</italic>
	</source>
                    <year>1989</year>;<volume>6</volume>(<issue>4</issue>):<fpage>283</fpage>&#x2013;<lpage>298</lpage>.
                    <pub-id pub-id-type="pmid">2695741</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-2">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Blake</surname>
                            <given-names>JA</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Eppig</surname>
                            <given-names>JT</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Kadin</surname>
                            <given-names>JA</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Mouse Genome Database (MGD)-2017: community knowledge resource for the laboratory mouse.</article-title>
                    <source>
		
                        <italic toggle="yes">Nucleic Acids Res.</italic>
	</source>
                    <year>2017</year>;<volume>45</volume>(<issue>D1</issue>):<fpage>D723</fpage>&#x2013;<lpage>D729</lpage>.
                    <pub-id pub-id-type="pmid">27899570</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/gkw1040</pub-id>
                    <pub-id pub-id-type="pmcid">5210536</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-3">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Cordeddu</surname>
                            <given-names>V</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Redeker</surname>
                            <given-names>B</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Stellacci</surname>
                            <given-names>E</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Mutations in 
                        <italic toggle="yes">ZBTB20</italic> cause Primrose syndrome.</article-title>
                    <source>
		
                        <italic toggle="yes">Nat Genet.</italic>
	</source>
                    <year>2014</year>;<volume>46</volume>(<issue>8</issue>):<fpage>815</fpage>&#x2013;<lpage>817</lpage>.
                    <pub-id pub-id-type="pmid">25017102</pub-id>
                    <pub-id pub-id-type="doi">10.1038/ng.3035</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-4">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>de Vree</surname>
                            <given-names>PJ</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>de Wit</surname>
                            <given-names>E</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Yilmaz</surname>
                            <given-names>M</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Targeted sequencing by proximity ligation for comprehensive variant detection and local haplotyping.</article-title>
                    <source>
		
                        <italic toggle="yes">Nat Biotechnol.</italic>
	</source>
                    <year>2014</year>;<volume>32</volume>(<issue>10</issue>):<fpage>1</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="pmid">25129690</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nbt.2959</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-5">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Games</surname>
                            <given-names>D</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Adams</surname>
                            <given-names>D</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Alessandrini</surname>
                            <given-names>R</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Alzheimer-type neuropathology in transgenic mice overexpressing V717F beta-amyloid precursor protein.</article-title>
                    <source>
		
                        <italic toggle="yes">Nature.</italic>
	</source>
                    <year>1995</year>;<volume>373</volume>(<issue>6514</issue>):<fpage>523</fpage>&#x2013;<lpage>527</lpage>.
                    <pub-id pub-id-type="pmid">7845465</pub-id>
                    <pub-id pub-id-type="doi">10.1038/373523a0</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-6">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Ghazi-Noori</surname>
                            <given-names>S</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Froud</surname>
                            <given-names>KE</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Mizielinska</surname>
                            <given-names>S</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Progressive neuronal inclusion formation and axonal degeneration in 
                        <italic toggle="yes">CHMP2B</italic> mutant transgenic mice.</article-title>
                    <source>
		
                        <italic toggle="yes">Brain.</italic>
	</source>
                    <year>2012</year>;<volume>135</volume>(<issue>Pt 3</issue>):<fpage>819</fpage>&#x2013;<lpage>832</lpage>.
                    <pub-id pub-id-type="pmid">22366797</pub-id>
                    <pub-id pub-id-type="doi">10.1093/brain/aws006</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-7">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Harris</surname>
                            <given-names>JA</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Devidze</surname>
                            <given-names>N</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Halabisky</surname>
                            <given-names>B</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Many neuronal and behavioral impairments in transgenic mouse models of Alzheimer&#x2019;s disease are independent of caspase cleavage of the amyloid precursor protein.</article-title>
                    <source>
		
                        <italic toggle="yes">J Neurosci.</italic>
	</source>
                    <year>2010</year>;<volume>30</volume>(<issue>1</issue>):<fpage>372</fpage>&#x2013;<lpage>381</lpage>.
                    <pub-id pub-id-type="pmid">20053918</pub-id>
                    <pub-id pub-id-type="doi">10.1523/JNEUROSCI.5341-09.2010</pub-id>
                    <pub-id pub-id-type="pmcid">3064502</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-8">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Haruyama</surname>
                            <given-names>N</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Cho</surname>
                            <given-names>A</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Kulkarni</surname>
                            <given-names>AB</given-names>
                        </name>
	</person-group>:
                    <article-title>Overview: engineering transgenic constructs and mice.</article-title>
                    <source>
	
                        <italic toggle="yes">Curr Protoc Cell Biol.</italic>
	</source>(Hoboken, NJ, USA: John Wiley &amp; Sons, Inc.),<year>2009</year>;<volume>Chapter 19</volume>:<fpage>Unit 19.10</fpage>.
                    <pub-id pub-id-type="pmid">19283728</pub-id>
                    <pub-id pub-id-type="doi">10.1002/0471143030.cb1910s42</pub-id>
                    <pub-id pub-id-type="pmcid">2743315</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-9">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Hong</surname>
                            <given-names>S</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Beja-Glasser</surname>
                            <given-names>VF</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Nfonoyim</surname>
                            <given-names>BM</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Complement and microglia mediate early synapse loss in Alzheimer mouse models.</article-title>
                    <source>
		
                        <italic toggle="yes">Science.</italic>
	</source>
                    <year>2016</year>;<volume>352</volume>(<issue>6286</issue>):<fpage>712</fpage>&#x2013;<lpage>716</lpage>.
                    <pub-id pub-id-type="pmid">27033548</pub-id>
                    <pub-id pub-id-type="doi">10.1126/science.aad8373</pub-id>
                    <pub-id pub-id-type="pmcid">5094372</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-10">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Hooli</surname>
                            <given-names>BV</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Kovacs-Vajna</surname>
                            <given-names>ZM</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Mullin</surname>
                            <given-names>K</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Rare autosomal copy number variations in early-onset familial Alzheimer&#x2019;s disease.</article-title>
                    <source>
		
                        <italic toggle="yes">Mol Psychiatry.</italic>
	</source>
                    <year>2014</year>;<volume>19</volume>(<issue>6</issue>):<fpage>676</fpage>&#x2013;<lpage>681</lpage>.
                    <pub-id pub-id-type="pmid">23752245</pub-id>
                    <pub-id pub-id-type="doi">10.1038/mp.2013.77</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-11">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Jacobsen</surname>
                            <given-names>JC</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Erdin</surname>
                            <given-names>S</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Chiang</surname>
                            <given-names>C</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Potential molecular consequences of transgene integration: The R6/2 mouse example.</article-title>
                    <source>
		
                        <italic toggle="yes">Sci Rep.</italic>
	</source>
                    <year>2017</year>;<volume>7</volume>: 41120.
                    <pub-id pub-id-type="pmid">28120936</pub-id>
                    <pub-id pub-id-type="doi">10.1038/srep41120</pub-id>
                    <pub-id pub-id-type="pmcid">5264158</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-12">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Mattioli</surname>
                            <given-names>F</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Piton</surname>
                            <given-names>A</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>G&#x00e9;rard</surname>
                            <given-names>B</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Novel de novo mutations in 
                        <italic toggle="yes">ZBTB20</italic> in Primrose syndrome with congenital hypothyroidism.</article-title>
                    <source>
		
                        <italic toggle="yes">Am J Med Genet Part A.</italic>
	</source>
                    <year>2016</year>;<volume>170</volume>(<issue>6</issue>):<fpage>1626</fpage>&#x2013;<lpage>1629</lpage>.
                    <pub-id pub-id-type="pmid">27061120</pub-id>
                    <pub-id pub-id-type="doi">10.1002/ajmg.a.37645</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-33">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Moore</surname>
                            <given-names>RC</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Lee</surname>
                            <given-names>IY</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Silverman</surname>
                            <given-names>GL</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Ataxia in prion protein (PrP)-deficient mice is associated with upregulation of the novel PrP-like protein doppel.</article-title>
                    <source>
		
                        <italic toggle="yes">J Mol Biol.</italic>
	</source>
                    <year>1999</year>;<volume>292</volume>(<issue>4</issue>):<fpage>797</fpage>&#x2013;<lpage>817</lpage>.
                    <pub-id pub-id-type="pmid">10525406</pub-id>
                    <pub-id pub-id-type="doi">10.1006/jmbi.1999.3108</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-13">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Mucke</surname>
                            <given-names>L</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Masliah</surname>
                            <given-names>E</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Yu</surname>
                            <given-names>GQ</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>High-level neuronal expression of abeta 1-42 in wild-type human amyloid protein precursor transgenic mice: synaptotoxicity without plaque formation.</article-title>
                    <source>
		
                        <italic toggle="yes">J Neurosci.</italic>
	</source>
                    <year>2000</year>;<volume>20</volume>(<issue>11</issue>):<fpage>4050</fpage>&#x2013;<lpage>4058</lpage>.
                    <pub-id pub-id-type="pmid">10818140</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-14">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Mullan</surname>
                            <given-names>M</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Crawford</surname>
                            <given-names>F</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Axelman</surname>
                            <given-names>K</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>A pathogenic mutation for probable Alzheimer&#x2019;s disease in the APP gene at the N-terminus of beta-amyloid.</article-title>
                    <source>
		
                        <italic toggle="yes">Nat Genet.</italic>
	</source>
                    <year>1992</year>;<volume>1</volume>(<issue>5</issue>):<fpage>345</fpage>&#x2013;<lpage>347</lpage>.
                    <pub-id pub-id-type="pmid">1302033</pub-id>
                    <pub-id pub-id-type="doi">10.1038/ng0892-345</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-15">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Murrell</surname>
                            <given-names>J</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Farlow</surname>
                            <given-names>M</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Ghetti</surname>
                            <given-names>B</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>A mutation in the amyloid precursor protein associated with hereditary Alzheimer&#x2019;s disease.</article-title>
                    <source>
		
                        <italic toggle="yes">Science.</italic>
	</source>
                    <year>1991</year>;<volume>254</volume>(<issue>5028</issue>):<fpage>97</fpage>&#x2013;<lpage>99</lpage>.
                    <pub-id pub-id-type="pmid">1925564</pub-id>
                    <pub-id pub-id-type="doi">10.1126/science.1925564</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-16">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Nielsen</surname>
                            <given-names>JV</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Blom</surname>
                            <given-names>JB</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Noraberg</surname>
                            <given-names>J</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Zbtb20-Induced CA1 Pyramidal Neuron Development and Area Enlargement in the Cerebral Midline Cortex of Mice.</article-title>
                    <source>
		
                        <italic toggle="yes">Cereb Cortex.</italic>
	</source>
                    <year>2010</year>;<volume>20</volume>(<issue>8</issue>):<fpage>1904</fpage>&#x2013;<lpage>1914</lpage>.
                    <pub-id pub-id-type="pmid">19955470</pub-id>
                    <pub-id pub-id-type="doi">10.1093/cercor/bhp261</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-17">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Palop</surname>
                            <given-names>JJ</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Mucke</surname>
                            <given-names>L</given-names>
                        </name>
	</person-group>:
                    <article-title>Network abnormalities and interneuron dysfunction in Alzheimer disease.</article-title>
                    <source>
		
                        <italic toggle="yes">Nat Rev Neurosci.</italic>
	</source>
                    <year>2016</year>;<volume>17</volume>(<issue>12</issue>):<fpage>777</fpage>&#x2013;<lpage>792</lpage>.
                    <pub-id pub-id-type="pmid">27829687</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nrn.2016.141</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-18">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Palop</surname>
                            <given-names>JJ</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Chin</surname>
                            <given-names>J</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Roberson</surname>
                            <given-names>ED</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Aberrant excitatory neuronal activity and compensatory remodeling of inhibitory hippocampal circuits in mouse models of Alzheimer&#x2019;s disease.</article-title>
                    <source>
		
                        <italic toggle="yes">Neuron.</italic>
	</source>
                    <year>2007</year>;<volume>55</volume>(<issue>5</issue>):<fpage>697</fpage>&#x2013;<lpage>711</lpage>.
                    <pub-id pub-id-type="pmid">17785178</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.neuron.2007.07.025</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-19">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Rasmussen</surname>
                            <given-names>MB</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Nielsen</surname>
                            <given-names>JV</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Louren&#x00e7;o</surname>
                            <given-names>CM</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Neurodevelopmental disorders associated with dosage imbalance of 
                        <italic toggle="yes">ZBTB20</italic> correlate with the morbidity spectrum of ZBTB20 candidate target genes.</article-title>
                    <source>
		
                        <italic toggle="yes">J Med Genet.</italic>
	</source>
                    <year>2014</year>;<volume>51</volume>(<issue>9</issue>):<fpage>605</fpage>&#x2013;<lpage>613</lpage>.
                    <pub-id pub-id-type="pmid">25062845</pub-id>
                    <pub-id pub-id-type="doi">10.1136/jmedgenet-2014-102535</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-20">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Roberson</surname>
                            <given-names>ED</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Scearce-Levie</surname>
                            <given-names>K</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Palop</surname>
                            <given-names>JJ</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Reducing endogenous tau ameliorates amyloid beta-induced deficits in an Alzheimer&#x2019;s disease mouse model.</article-title>
                    <source>
		
                        <italic toggle="yes">Science.</italic>
	</source>
                    <year>2007</year>;<volume>316</volume>(<issue>5825</issue>):<fpage>750</fpage>&#x2013;<lpage>754</lpage>.
                    <pub-id pub-id-type="pmid">17478722</pub-id>
                    <pub-id pub-id-type="doi">10.1126/science.1141736</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-21">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Robinson</surname>
                            <given-names>JT</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Thorvaldsd&#x00f3;ttir</surname>
                            <given-names>H</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Winckler</surname>
                            <given-names>W</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Integrative genomics viewer.</article-title>
                    <source>
		
                        <italic toggle="yes">Nat Biotechnol.</italic>
	</source>
                    <year>2011</year>;<volume>29</volume>(<issue>1</issue>):<fpage>24</fpage>&#x2013;<lpage>26</lpage>.
                    <pub-id pub-id-type="pmid">21221095</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nbt.1754</pub-id>
                    <pub-id pub-id-type="pmcid">3346182</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-22">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Rockenstein</surname>
                            <given-names>EM</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>McConlogue</surname>
                            <given-names>L</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Tan</surname>
                            <given-names>H</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Levels and alternative splicing of amyloid beta protein precursor (APP) transcripts in brains of APP transgenic mice and humans with Alzheimer&#x2019;s disease.</article-title>
                    <source>
		
                        <italic toggle="yes">J Biol Chem.</italic>
	</source>
                    <year>1995</year>;<volume>270</volume>(<issue>47</issue>):<fpage>28257</fpage>&#x2013;<lpage>28267</lpage>.
                    <pub-id pub-id-type="pmid">7499323</pub-id>
                    <pub-id pub-id-type="doi">10.1074/jbc.270.47.28257</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-23">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Sanchez</surname>
                            <given-names>PE</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Zhu</surname>
                            <given-names>L</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Verret</surname>
                            <given-names>L</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Levetiracetam suppresses neuronal network dysfunction and reverses synaptic and cognitive deficits in an Alzheimer&#x2019;s disease model.</article-title>
                    <source>
		
                        <italic toggle="yes">Proc Natl Acad Sci U S A.</italic>
	</source>
                    <year>2012</year>;<volume>109</volume>(<issue>42</issue>):<fpage>E2895</fpage>&#x2013;<lpage>903</lpage>.
                    <pub-id pub-id-type="pmid">22869752</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.1121081109</pub-id>
                    <pub-id pub-id-type="pmcid">3479491</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-24">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Sasahara</surname>
                            <given-names>M</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Fries</surname>
                            <given-names>JW</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Raines</surname>
                            <given-names>EW</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>PDGF B-chain in neurons of the central nervous system, posterior pituitary, and in a transgenic model.</article-title>
                    <source>
		
                        <italic toggle="yes">Cell.</italic>
	</source>
                    <year>1991</year>;<volume>64</volume>(<issue>1</issue>):<fpage>217</fpage>&#x2013;<lpage>227</lpage>.
                    <pub-id pub-id-type="pmid">1986868</pub-id>
                    <pub-id pub-id-type="doi">10.1016/0092-8674(91)90223-L</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-25">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Schwanh&#x00e4;usser</surname>
                            <given-names>B</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Busse</surname>
                            <given-names>D</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>N</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Global quantification of mammalian gene expression control.</article-title>
                    <source>
		
                        <italic toggle="yes">Nature.</italic>
	</source>
                    <year>2011</year>;<volume>473</volume>(<issue>7374</issue>):<fpage>337</fpage>&#x2013;<lpage>342</lpage>.
                    <pub-id pub-id-type="pmid">21593866</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nature10098</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-26">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Schwanh&#x00e4;usser</surname>
                            <given-names>B</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Busse</surname>
                            <given-names>D</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>N</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Corrigendum: Global quantification of mammalian gene expression control.</article-title>
                    <source>
		
                        <italic toggle="yes">Nature.</italic>
	</source>
                    <year>2013</year>;<volume>495</volume>(<issue>7439</issue>):<fpage>126</fpage>&#x2013;<lpage>127</lpage>.
                    <pub-id pub-id-type="pmid">23407496</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nature11848</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-27">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Skibinski</surname>
                            <given-names>G</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Parkinson</surname>
                            <given-names>NJ</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Brown</surname>
                            <given-names>JM</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Mutations in the endosomal ESCRTIII-complex subunit CHMP2B in frontotemporal dementia.</article-title>
                    <source>
		
                        <italic toggle="yes">Nat Genet.</italic>
	</source>
                    <year>2005</year>;<volume>37</volume>(<issue>8</issue>):<fpage>806</fpage>&#x2013;<lpage>808</lpage>.
                    <pub-id pub-id-type="pmid">16041373</pub-id>
                    <pub-id pub-id-type="doi">10.1038/ng1609</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-28">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Tosh</surname>
                            <given-names>JL</given-names>
                        </name>
	</person-group>:
                    <article-title>J20 Transgene Mapping</article-title>.<year>2017</year>.
                    <pub-id pub-id-type="doi">10.17605/OSF.IO/4UGZF</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-29">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Truett</surname>
                            <given-names>GE</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Heeger</surname>
                            <given-names>P</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Mynatt</surname>
                            <given-names>RL</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT).</article-title>
                    <source>
		
                        <italic toggle="yes">Biotechniques.</italic>
	</source>
                    <year>2000</year>;<volume>29</volume>(<issue>1</issue>):<fpage>52</fpage>,<fpage>54</fpage>.
                    <pub-id pub-id-type="pmid">10907076</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-30">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Wilhelm</surname>
                            <given-names>M</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Schlegl</surname>
                            <given-names>J</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Hahne</surname>
                            <given-names>H</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Mass-spectrometry-based draft of the human proteome.</article-title>
                    <source>
		
                        <italic toggle="yes">Nature.</italic>
	</source>
                    <year>2014</year>;<volume>509</volume>(<issue>7502</issue>):<fpage>582</fpage>&#x2013;<lpage>587</lpage>.
                    <pub-id pub-id-type="pmid">24870543</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nature13319</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-31">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Xie</surname>
                            <given-names>Z</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Zhang</surname>
                            <given-names>H</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Tsai</surname>
                            <given-names>W</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Zinc finger protein ZBTB20 is a key repressor of alpha-fetoprotein gene transcription in liver.</article-title>
                    <source>
		
                        <italic toggle="yes">Proc Natl Acad Sci.</italic>
	</source>
                    <year>2008</year>;<volume>105</volume>(<issue>31</issue>):<fpage>10859</fpage>&#x2013;<lpage>10864</lpage>.
                    <pub-id pub-id-type="pmid">18669658</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.0800647105</pub-id>
                    <pub-id pub-id-type="pmcid">2504784</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-32">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
		
                        <name name-style="western">
                            <surname>Yan</surname>
                            <given-names>BW</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Zhao</surname>
                            <given-names>YF</given-names>
                        </name>
		
                        <name name-style="western">
                            <surname>Cao</surname>
                            <given-names>WG</given-names>
                        </name>
		
                        <etal/>
	</person-group>:
                    <article-title>Mechanism of random integration of foreign DNA in transgenic mice.</article-title>
                    <source>
		
                        <italic toggle="yes">Transgenic Res.</italic>
	</source>
                    <year>2013</year>;<volume>22</volume>(<issue>5</issue>):<fpage>983</fpage>&#x2013;<lpage>992</lpage>.
                    <pub-id pub-id-type="pmid">23483296</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s11248-013-9701-z</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report26484">
        <front-stub>
            <article-id pub-id-type="doi">10.21956/wellcomeopenres.13248.r26484</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Pavlovic</surname>
                        <given-names>Guillaume</given-names>
                    </name>
                    <xref ref-type="aff" rid="r26484a1">1</xref>
                    <xref ref-type="aff" rid="r26484a2">2</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-9122-4592</uri>
                </contrib>
                <aff id="r26484a1">
                    <label>1</label>PHENOMIN-ICS, Strasbourg, France</aff>
                <aff id="r26484a2">
                    <label>2</label>Institut Clinique de la Souris (ICS), CNRS, INSERM, University of Strasbourg, Illkirch, France</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>16</day>
                <month>10</month>
                <year>2017</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2017 Pavlovic G</copyright-statement>
                <copyright-year>2017</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport26484" related-article-type="peer-reviewed-article" xlink:href="10.12688/wellcomeopenres.12237.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The authors have found non mendalian ratio in cross between Chrmp2b-/- and J20+/- animals. They found that J20 transgene is integrated ~22 Mb of the Chrmp2b gene in the Zbtb20 gene.</p>
            <p> The report is well written, easy to understand and relevant. However, the Western Blot data does not allow to conclude that 
                <italic>Zbtb20</italic> protein expression remains unchanged.</p>
            <p> Comments:</p>
            <p> - Figure 3</p>
            <p> Unpaired t-test: your statistical analysis hypothesize normal distribution of the data. Using a non parametric test will be more correct if you do not provide the normality test results.</p>
            <p> Please indicate what are the error bars (SEM, SD or 95% Cl)?</p>
            <p> - Assessment of ZBTB20 expression: Western Blot analysis</p>
            <p> The western blot results provided in the paper do not prove that the &#x201c;ZBTB20 protein is unaltered in adult J20 hippocampal tissue&#x201d;. Knock-out controls and molecular size markers are missing to prove that the showed band is not an unspecific signal.</p>
            <p> Moreover, the lack of appropriate controls (i.e. different quantity of protein extract) do not allow to validate the use of Figure 2B as a quantitative Western Blot. See why in the publications 1 to 3</p>
            <p> Finally, as recommended in PLOS ONE for example (
                <ext-link ext-link-type="uri" xlink:href="http://journals.plos.org/plosone/s/submission-guidelines">http://journals.plos.org/plosone/s/submission-guidelines</ext-link>), the author should provide: 
                <list list-type="bullet">
                    <list-item>
                        <p>Original uncropped and unadjusted blots and gels, including molecular size markers, should be provided in either the figures or the supplementary files.</p>
                    </list-item>
                    <list-item>
                        <p>The image should include all relevant controls, and controls should be run on the same blot or gel as the samples.</p>
                    </list-item>
                    <list-item>
                        <p>All blots and gels that support results reported in the manuscript should be provided. Please provide ZBTB20 additional antibody results (which are data not shown in the paper) as additional files. Add reference of this additional antibody in material and methods.</p>
                    </list-item>
                </list>
            </p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Partly</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Partly</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Partly</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <back>
            <ref-list>
                <title>References</title>
                <ref id="rep-ref-26484-1">
                    <label>1</label>
                    <mixed-citation publication-type="journal">
                        <person-group person-group-type="author"/>:
                        <article-title>The design of a quantitative western blot experiment.</article-title>
                        <source>
                            <italic>Biomed Res Int</italic>
                        </source>.<year>2014</year>;<volume>2014</volume>:
                        <elocation-id>10.1155/2014/361590</elocation-id>
                        <fpage>361590</fpage>
                        <pub-id pub-id-type="pmid">24738055</pub-id>
                        <pub-id pub-id-type="doi">10.1155/2014/361590</pub-id>
                    </mixed-citation>
                </ref>
                <ref id="rep-ref-26484-2">
                    <label>2</label>
                    <mixed-citation publication-type="journal">
                        <person-group person-group-type="author"/>:
                        <article-title>A defined methodology for reliable quantification of Western blot data.</article-title>
                        <source>
                            <italic>Mol Biotechnol</italic>
                        </source>.<year>2013</year>;<volume>55</volume>(<issue>3</issue>) :
                        <elocation-id>10.1007/s12033-013-9672-6</elocation-id>
                        <fpage>217</fpage>-<lpage>26</lpage>
                        <pub-id pub-id-type="pmid">23709336</pub-id>
                        <pub-id pub-id-type="doi">10.1007/s12033-013-9672-6</pub-id>
                    </mixed-citation>
                </ref>
                <ref id="rep-ref-26484-3">
                    <label>3</label>
                    <mixed-citation publication-type="journal">
                        <person-group person-group-type="author"/>:
                        <article-title>The necessity of and strategies for improving confidence in the accuracy of western blots.</article-title>
                        <source>
                            <italic>Expert Rev Proteomics</italic>
                        </source>.<year>2014</year>;<volume>11</volume>(<issue>5</issue>) :
                        <elocation-id>10.1586/14789450.2014.939635</elocation-id>
                        <fpage>549</fpage>-<lpage>60</lpage>
                        <pub-id pub-id-type="pmid">25059473</pub-id>
                        <pub-id pub-id-type="doi">10.1586/14789450.2014.939635</pub-id>
                    </mixed-citation>
                </ref>
            </ref-list>
        </back>
        <sub-article article-type="response" id="comment3700-26484">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Tosh</surname>
                            <given-names>Justin</given-names>
                        </name>
                        <aff>University College London, Institute of Neurology, UK</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>23</day>
                    <month>9</month>
                    <year>2018</year>
                </pub-date>
            </front-stub>
            <body>
                <p>The authors thank Dr Pavlovic for his insightful comments.</p>
                <p>We have updated the figure legend to reflect the reviewers comments (error bars are SEM) and&#x00a0; have also sign-posted the link to the supplementary data in the legend for Figure 3; where all primary data including uncropped blots can be viewed, and note that the analysis of our western blots complied with best practice (
                    <ext-link ext-link-type="uri" xlink:href="http://journals.plos.org/plosone/s/submission-guidelines">http://journals.plos.org/plosone/s/submission-guidelines</ext-link>).</p>
                <p>In our qPCR and western blot experiments we could not test for, or assume normality of data distribution, so an alternative non-parametric test was used instead (Mann-Whitney U).</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report25970">
        <front-stub>
            <article-id pub-id-type="doi">10.21956/wellcomeopenres.13248.r25970</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Saido</surname>
                        <given-names>Takaomi C.</given-names>
                    </name>
                    <xref ref-type="aff" rid="r25970a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r25970a1">
                    <label>1</label>Laboratory for Proteolytic Neuroscience, RIKEN Brain Science Institute, Saitama, Japan</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>25</day>
                <month>9</month>
                <year>2017</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2017 Saido TC</copyright-statement>
                <copyright-year>2017</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport25970" related-article-type="peer-reviewed-article" xlink:href="10.12688/wellcomeopenres.12237.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>Gene expression is regulated by promoters, enhancers, silencers, etc. in a tissue-specific manner. For instance, Zbtb20 plays an essential role in hepatic 
                <italic>de novo</italic> lipogenesis, so it is necessary to examine the mRNA and protein levels of Zbtb20 in all the tissues in addition to hippocampus including the liver because the transgene is inserted into every corresponding chromosome. In particular, it is surprising that the authors avoided examining developed and developing cortex because Zbtb20 modulates the sequential generation of neuronal layers in developing cortex. It would also be quite convincing if there was a negative control in Figure 3B (and in additional Western blot data) using tissues from Zbtb20-KO mice. One comment on the Western blot data, the quantities of protein are not sufficently normalized.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Partly</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Partly</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Partly</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Partly</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Partly</p>
            <p>Reviewer Expertise:</p>
            <p>Neuroscience</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <back>
            <ref-list>
                <title>References</title>
                <ref id="rep-ref-25970-1">
                    <label>1</label>
                    <mixed-citation publication-type="journal">
                        <person-group person-group-type="author"/>:
                        <article-title>Zbtb20 modulates the sequential generation of neuronal layers in developing cortex.</article-title>
                        <source>
                            <italic>Mol Brain</italic>
                        </source>.<year>2016</year>;<volume>9</volume>(<issue>1</issue>) :
                        <elocation-id>10.1186/s13041-016-0242-2</elocation-id>
                        <fpage>65</fpage>
                        <pub-id pub-id-type="pmid">27282384</pub-id>
                        <pub-id pub-id-type="doi">10.1186/s13041-016-0242-2</pub-id>
                    </mixed-citation>
                </ref>
                <ref id="rep-ref-25970-2">
                    <label>2</label>
                    <mixed-citation publication-type="journal">
                        <person-group person-group-type="author"/>:
                        <article-title>Regulation of hepatic lipogenesis by the zinc finger protein Zbtb20.</article-title>
                        <source>
                            <italic>Nat Commun</italic>
                        </source>.<year>2017</year>;<volume>8</volume>:
                        <elocation-id>10.1038/ncomms14824</elocation-id>
                        <fpage>14824</fpage>
                        <pub-id pub-id-type="pmid">28327662</pub-id>
                        <pub-id pub-id-type="doi">10.1038/ncomms14824</pub-id>
                    </mixed-citation>
                </ref>
            </ref-list>
        </back>
        <sub-article article-type="response" id="comment3701-25970">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Tosh</surname>
                            <given-names>Justin</given-names>
                        </name>
                        <aff>University College London, Institute of Neurology, UK</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>23</day>
                    <month>9</month>
                    <year>2018</year>
                </pub-date>
            </front-stub>
            <body>
                <p>The authors thank Dr Saido for his insightful comments.</p>
                <p>We agree the transgene is inserted into 
                    <italic>Zbtb20</italic> in every cell of the body, and therefore may affect multiple organs. However it is beyond the scope of this initial characterization of the genomic location of the 
                    <italic>APP </italic>transgene in the J20 animal model to study transcription of 
                    <italic>Zbtb20</italic> in every organ of the mouse. We wished to communicate the issue of disruption of the 
                    <italic>Zbtb20</italic> locus to the scientific community immediately so that further detailed studies can be undertaken. &#x00a0;</p>
                <p>We note that have not been able to source tissue from either Zbtb20
                    <sup>-/-</sup> or Zbtb20
                    <sup>-/+</sup> mice, and that Zbtb20
                    <sup>-/-</sup> mice have poor postnatal survival (Sutherland 2009). Thus it is not possible at this time to verify the results presented in Figure 3B using an appropriate negative control (adult hippocampus from a Zbtb20
                    <sup>-/-</sup>). Therefore we agree that until we can undertake this important validation of the experiment, we cannot state categorically that the ZBTB20 protein level is unchanged in the J20 model system and have edited our paper accordingly.</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report25971">
        <front-stub>
            <article-id pub-id-type="doi">10.21956/wellcomeopenres.13248.r25971</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Ashe</surname>
                        <given-names>Karen H.</given-names>
                    </name>
                    <xref ref-type="aff" rid="r25971a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r25971a1">
                    <label>1</label>Department of Neurology, University of Minnesota, Minneapolis, MN, 55455, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>19</day>
                <month>9</month>
                <year>2017</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2017 Ashe KH</copyright-statement>
                <copyright-year>2017</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport25971" related-article-type="peer-reviewed-article" xlink:href="10.12688/wellcomeopenres.12237.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The authors have shown that an unexpected ratio of genotypes that occurred when J20 mice were bred to Chmp2b KO mice was due to the insertion of the J20 transgene array near the Chmp2b gene, resultig in linkage disequilibrium. The report is interesting, relevant and well-done. The only correction I recommend is to change Figure 1 so that the colors in the rectangles match the colors of the mice (e.g., make the orange rectangle red and the red rectangle orange).</p>
            <p> </p>
            <p> </p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Partly</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Neurobiology of Alzheimer's disease</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
        <sub-article article-type="response" id="comment3699-25971">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Tosh</surname>
                            <given-names>Justin</given-names>
                        </name>
                        <aff>University College London, Institute of Neurology, UK</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>23</day>
                    <month>9</month>
                    <year>2018</year>
                </pub-date>
            </front-stub>
            <body>
                <p>The authors thank Professor Ashe for her insightful comments. In Version 2 of the article we have altered Figure 1 to improve colour clarity as suggested.</p>
            </body>
        </sub-article>
    </sub-article>
</article>
